Journal:

Article Title: Promoters P3 , Pa / Pb , P4 , and P5 Upstream from bla TEM Genes and Their Relationship to ?-Lactam Resistance

doi: 10.1128/AAC.46.12.4035-4037.2002

Figure Lengend Snippet: β-Lactam susceptibility and β-lactamase activity of TEM-1- and TEM-30 (IRT-2)-producing E. coli transformants according to the type of promoter upstream from the bla TEM-1B and bla TEM-30B genes

Article Snippet: This difference suggests that other nucleotide motifs than TTG in the promoter region might be involved in gene expression. table ft1 table-wrap mode="anchored" t5 caption a7 Strain and bla TEM gene (promoter) MIC (μg/ml) a β-Lactamase activity (U/mg) (mean ± SD) AMC (≤4->16) TIC (≤16->64) TCC (≤16->64) PIP (≤8->64) TZB (≤8->64) CEP (≤8->32) E. coli ATCC 25 922 4 4 4 2 1 8 ND b NM554 2 2 2 1 1 2 ND Transformant NM554 bla TEM-1B ( P3 ) 32 8,192 32 128 1 8 6.8 ± 3.3 bla TEM-1B ( Pa/Pb ) 128 >8,192 256 512 2 32 13.8 ± 2.1 bla TEM-1B ( P4 ) 512 >8,192 1,024 1,024 128 64 38 ± 9 bla TEM-1B ( P5 ) 1,024 >8,192 2,048 >1,024 512 128 87.4 ± 8 bla TEM-30B ( P3 ) 256 128 32 8 1 8 14 ± 4.4 bla TEM-30B ( Pa/Pb ) 2,048 512 128 64 2 8 32.6 ± 5.6 bla TEM-30B ( P4 ) 4,096 2,048 512 64 32 8 120 ± 7.9 Open in a separate window a Drug abbreviations: AMC, amoxicillin with 2 μg of clavulanate per ml; TIC, ticarcillin; TCC, ticarcillin with 2 μg of clavulanate per ml; PIP, piperacillin; TZB, piperacillin with 4 μg of tazobactam per ml; CEP, cephalothin.

Techniques: Activity Assay

Journal: Indian Journal of Ophthalmology

Article Title: Prevalence and antibacterial resistance patterns of extended-spectrum beta-lactamase producing Gram-negative bacteria isolated from ocular infections

doi: 10.4103/0301-4738.182943

Figure Lengend Snippet: Phenotypic confirmatory test results of cephalosporin/ clavulanate combination disc test. (a) Negative control E. coli ATCC 25922; (b) positive control K. pneumoniae ATCC 700603; (c) test isolate E. coli 3923 from canaliculus pus specimen. CTX: Cefotaxime (30 μg), CAZ: Ceftazidime (30 μg), CTX/CA: Cefotaxime/clavulanic acid (30 μg/10 μg), CAZ/CA: Ceftazidime/clavulanic acid (30 μg/10 μg). E. coli : Escherichia coli , K. pneumonia : Klebsiella pneumoniae

Article Snippet: Along with the test isolates, DNA of bla CTX-M -gene carrying E. coli 4712 (positive control for bla CTX-M-15 ; GenBank accession number KC200080), DNA of bla SHV -gene carrying K. pneumoniae (ATCC 700603) (positive control for bla SHV -gene),[ ] DNA of bla TEM -gene carrying E. coli (ATCC 35218) (positive control for bla TEM -gene),[ ] DNA of bla OXA -gene laboratory isolate of K. pneumoniae 7888 (positive control for bla OXA -gene GenBank accession number JN565742), and DNA of non-ESBL-producing organism, E. coli ATCC 25922 were also extracted for performing positive and negative control during each mPCR.

Techniques: Negative Control, Positive Control

Journal: Indian Journal of Ophthalmology

Article Title: Prevalence and antibacterial resistance patterns of extended-spectrum beta-lactamase producing Gram-negative bacteria isolated from ocular infections

doi: 10.4103/0301-4738.182943

Figure Lengend Snippet: Agarose gel electrophoresis of multiplex polymerase chain reaction products for bla TEM , bla SHV , and bla OXA -genes. Lane NC1 and NC2: Negative controls, Lane 1: E. coli ATCC 25922 (negative control for extended-spectrum beta-lactamase genes), Lane 2: P. aeruginosa 13134 strain positive for bla TEM -gene (800 bp) alone, Lane 3: E. agglomerans 4245 strain positive for bla SHV -gene (713 bp) alone, Lane 4: P. aeruginosa 13111 strain positive for bla OXA -gene (564 bp) alone, Lane 5: P. aeruginosa 4211 strain positive for both bla TEM and bla SHV -genes (800 bp and 713 bp), Lane 6: P. aeruginosa 12839 strain positive for both bla TEM and bla OXA -genes (800 bp, 564 bp), Lane 7: A. hydrophila 4019 strain positive for both bla SHV and bla OXA -genes (713 bp, 564 bp), Lane PC: Positive control, Lane MW – Marker 100 bp DNA ladder. E. coli : Escherichia coli , P. aeruginosa : Pseudomonas aeruginosa , A. hydrophila: Aeromonas hydrophila , E. agglomerans : Enterobacter agglomerans

Article Snippet: Along with the test isolates, DNA of bla CTX-M -gene carrying E. coli 4712 (positive control for bla CTX-M-15 ; GenBank accession number KC200080), DNA of bla SHV -gene carrying K. pneumoniae (ATCC 700603) (positive control for bla SHV -gene),[ ] DNA of bla TEM -gene carrying E. coli (ATCC 35218) (positive control for bla TEM -gene),[ ] DNA of bla OXA -gene laboratory isolate of K. pneumoniae 7888 (positive control for bla OXA -gene GenBank accession number JN565742), and DNA of non-ESBL-producing organism, E. coli ATCC 25922 were also extracted for performing positive and negative control during each mPCR.

Techniques: Agarose Gel Electrophoresis, Multiplex Assay, Polymerase Chain Reaction, Negative Control, Positive Control, Marker

Journal: Antimicrobial Resistance and Infection Control

Article Title: High frequency and molecular epidemiology of metallo-β-lactamase-producing gram-negative bacilli in a tertiary care hospital in Lahore, Pakistan

doi: 10.1186/s13756-018-0417-y

Figure Lengend Snippet: List of the Primers used for the detection of ESBL-Type variant ( bla OXA, bla TEM and bla SHV) and MBL-type variants ( bla IMP-1 and bla VIM )

Article Snippet: The bla TEM gene was found to coexist with bla OXA -type variants in 21% ( n = 30) of the MBL producers.

Techniques: Variant Assay, Bla VIM Assay

Journal: Antimicrobial Resistance and Infection Control

Article Title: High frequency and molecular epidemiology of metallo-β-lactamase-producing gram-negative bacilli in a tertiary care hospital in Lahore, Pakistan

doi: 10.1186/s13756-018-0417-y

Figure Lengend Snippet: Frequencies of different gene variants ( TEM, SHV, OXA, VIM, IMP ) in MBL producing clinical isolates. The presence of genes bla OXA , bla TEM , bla SHV bla IMP-1 and bla VIM was detected in MBL strains through PCR

Article Snippet: The bla TEM gene was found to coexist with bla OXA -type variants in 21% ( n = 30) of the MBL producers.

Techniques: Bla VIM Assay

Journal: Frontiers in Microbiology

Article Title: Occurrence of Indicator Genes of Antimicrobial Resistance Contamination in the English Channel and North Sea Sectors and Interactions With Environmental Variables

doi: 10.3389/fmicb.2022.883081

Figure Lengend Snippet: Primer and probe sequences and conditions associated to the quantitative PCR (qPCR) used in this study.

Article Snippet: For qPCR negative controls, we used three Vibrio parahaemolyticus strains (ANSES B3PA Collection, Boulogne-sur-Mer, France): B3PA-12-1,629 strain without bla TEM gene, B3PA-13-2,931 strain without the intI1 gene and B3PA-15-0205 strain without the tetA and sul1 genes.

Techniques: Real-time Polymerase Chain Reaction

Journal: Frontiers in Microbiology

Article Title: Occurrence of Indicator Genes of Antimicrobial Resistance Contamination in the English Channel and North Sea Sectors and Interactions With Environmental Variables

doi: 10.3389/fmicb.2022.883081

Figure Lengend Snippet: Relative abundance of the tetA , sul1 , and intI1 indicator genes in the seawater samples, for the six areas. EC, East English Channel; EE, East England coast; MNS, Middle of the North Sea; NN, North Netherlands coast; T, Thames mouth; and WN, West Netherlands coast. The color key indicates the relative abundance in the respective samples. The white rectangles indicate an absence of quantification. The bla TEM gene was not quantified.

Article Snippet: For qPCR negative controls, we used three Vibrio parahaemolyticus strains (ANSES B3PA Collection, Boulogne-sur-Mer, France): B3PA-12-1,629 strain without bla TEM gene, B3PA-13-2,931 strain without the intI1 gene and B3PA-15-0205 strain without the tetA and sul1 genes.

Techniques:

Journal: Antimicrobial Agents and Chemotherapy

Article Title: Role of Synonymous Mutations in the Evolution of TEM β-Lactamase Genes

doi: 10.1128/AAC.00018-21

Figure Lengend Snippet: Summary of the characteristics of the different bla TEM gene constructs without (−sm) and with (+sm) synonymous mutations

Article Snippet: Genes encoding the various bla TEM genes were purchased from Gen9, Inc. (Cambridge, MA) or Biomatik (Kitchener, ON, Canada); genes had a SacI restriction site followed by a ribosome binding site (5′- GAGCTCAAGAAGGAGATATACAT -3′) on the 5′ terminus and a BamHI restriction site (5′-GGATCC-3′) immediately following the 3′ terminal stop codon.

Techniques: Construct, Expressing

Journal: Antimicrobial Agents and Chemotherapy

Article Title: Role of Synonymous Mutations in the Evolution of TEM β-Lactamase Genes

doi: 10.1128/AAC.00018-21

Figure Lengend Snippet: Summary of the characteristics of the different gene constructs from bla TEM-1 to bla TEM-33 (+sm) c

Article Snippet: Genes encoding the various bla TEM genes were purchased from Gen9, Inc. (Cambridge, MA) or Biomatik (Kitchener, ON, Canada); genes had a SacI restriction site followed by a ribosome binding site (5′- GAGCTCAAGAAGGAGATATACAT -3′) on the 5′ terminus and a BamHI restriction site (5′-GGATCC-3′) immediately following the 3′ terminal stop codon.

Techniques: Construct, Diffusion-based Assay, Microdilution Assay

Journal: Veterinary and Animal Science

Article Title: Exploring of spectrum beta lactamase producing multidrug-resistant Salmonella enterica serovars in goat meat markets of Bangladesh

doi: 10.1016/j.vas.2024.100367

Figure Lengend Snippet: Primers used in PCR test of Salmonella enterica serovars and Beta-lactams resistant genes.

Article Snippet: This study specifically concentrated on the isolation and identification of ESBL-resistant genes ( bla TEM, bla SHV, bla CTX-M1, bla CTX-M2, bla CTX-M9, MultiCase ACC, MultiCase MOX, MultiCase DHA, bla OXA ) and the antibiogram profiling of Salmonella enterica serovars found in goat meat samples procured from retail outlets in Bangladesh.

Techniques: Sequencing

Journal: Veterinary and Animal Science

Article Title: Exploring of spectrum beta lactamase producing multidrug-resistant Salmonella enterica serovars in goat meat markets of Bangladesh

doi: 10.1016/j.vas.2024.100367

Figure Lengend Snippet: Amplified DNA of invA gene of Salmonella isolates at 284 bp, PC: Positive control as Salmonella spp. ATCC 700623 ( A); sefA gene of Salmonella Enteritidis Isolated at 488 bp, PC: Positive control as Salmonella enterica ser. Enteritidis ATCC 13076 ( B); fliC gene of Salmonella Typhimurium Isolated at 620 bp, PC: Positive control as Salmonella enterica ser. Typhimurium ATCC 700720 ( C); NC: Negative control (Nuclease free water) Amplified DNA of ESBL Resistance genes of Salmonella spp. from first multiplex PCR test. Lane M: 100bp DNA Ladder, Lane M: 100bp DNA ladder, bla TEM gene at 800bp position. Lane 2: bla SHV gene at 713 bp ( D).

Article Snippet: This study specifically concentrated on the isolation and identification of ESBL-resistant genes ( bla TEM, bla SHV, bla CTX-M1, bla CTX-M2, bla CTX-M9, MultiCase ACC, MultiCase MOX, MultiCase DHA, bla OXA ) and the antibiogram profiling of Salmonella enterica serovars found in goat meat samples procured from retail outlets in Bangladesh.

Techniques: Amplification, Positive Control, Isolation, Negative Control, Multiplex Assay

Journal: Veterinary and Animal Science

Article Title: Exploring of spectrum beta lactamase producing multidrug-resistant Salmonella enterica serovars in goat meat markets of Bangladesh

doi: 10.1016/j.vas.2024.100367

Figure Lengend Snippet: Frequency of beta-lactams resistance genes in Salmonella Enteritidis and Typhimurium isolated from retail goat meat.

Article Snippet: This study specifically concentrated on the isolation and identification of ESBL-resistant genes ( bla TEM, bla SHV, bla CTX-M1, bla CTX-M2, bla CTX-M9, MultiCase ACC, MultiCase MOX, MultiCase DHA, bla OXA ) and the antibiogram profiling of Salmonella enterica serovars found in goat meat samples procured from retail outlets in Bangladesh.

Techniques: Isolation